Kidney International Reports
○ Elsevier BV
All preprints, ranked by how well they match Kidney International Reports's content profile, based on 11 papers previously published here. The average preprint has a 0.07% match score for this journal, so anything above that is already an above-average fit. Older preprints may already have been published elsewhere.
Apple, B.; Sartori, G.; Moore, B.; Chintam, K.; Singh, G.; Mohan Anand, P.; Strande, N.; Mirshahi, T.; Triffo, W.; Chang, A.
Show abstract
BackgroundHeterozygous ALG8 variants have previously been associated with polycystic liver disease (PLD) with or without kidney cysts. A clear-cut relationship between application of PKD diagnostic criteria and kidney manifestations of ALG8 variants remains to be described. We therefore sought to determine whether ALG8 protein-truncating variant (PTV) heterozygotes are at increased risk of polycystic kidney disease (PKD). MethodsWe identified participants heterozygous for pathogenic (P) and likely pathogenic (LP) ALG8 (NM_024079.5) PTVs described in ClinVar from the Geisinger-Regeneron DiscovEHR MyCode study, an unselected health system-based cohort linked to electronic health records. ALG8 PTV heterozygotes were matched 1:1 to non-heterozygote family members by age at time of imaging (within 10 years) and sex. Phenotypes were assessed by International Classification of Disease (ICD) codes, chart review, and imaging, which was reviewed by a blinded radiologist. Imaging diagnosis of PKD was defined as [≥]4 kidney cysts on an abdominal ultrasound or computed tomography. Secondary outcomes included bilateral renal cysts, and [≥]1 liver cyst. ResultsOut of 174,418 participants in MyCode,103 participants (mean age 56.7 years) were heterozygous for an ALG8 P/LP variant: p.Arg364Ter (n=86), p.Arg41Ter (n=7), p.Arg179Ter (n=9), and c.368+2T>G (n=2). None of the ALG8 P/LP variant heterozygotes had an ICD diagnosis of PKD or PLD. Out of 51 participants [≥]40 years of age with available imaging, 51% had [≥]4 renal cysts and 14% had [≥]1 liver cyst. After matching 23 ALG8 P/LP variant heterozygotes with 23 related non-heterozygotes by age and imaging modality, ALG8 P/LP heterozygotes had higher prevalence of 4+ kidney cysts (48% versus 9% in non-heterozygotes; p=0.007) and bilateral kidney cysts (61% vs. 17%; p=0.006). ConclusionsOur study demonstrates that patients heterozygous for ALG8 P/LP variants are at increased risk of PKD on imaging but not by ICD diagnosis codes. Additional studies are needed to determine whether ALG8 P/LP heterozygotes are at increased risk of kidney failure.
Meier, M.; Schoberth, M.; Li, Y.; Borisov, O.; Uluvar, B.; Willecke, C.; Meiselbach, H.; Eckardt, K.-U.; Schilling, O.; Kottgen, A.; Haug, S.
Show abstract
Urinary proteins are valuable biomarkers for physiological processes and early detection and monitoring of systemic and kidney diseases. However, comprehensive quantification and characterization of the urine proteome using high-throughput platforms remains limited. Using an affinity-based assay for large-scale proteomics, the Olink Explore 3072 platform, we quantified 2,868 proteins in urine samples from 1,268 participants of the German Chronic Kidney Disease (GCKD) study. Protein detectability in urine, defined as the percentage of samples with measurements above the limit of detection, showed a bimodal distribution: 659 (23%) proteins had high (>80%) and 1,336 proteins (47%) had low (<20%) detectability. Over 95% of highly detectable proteins were confirmed as present in urine by mass spectrometry. They were enriched for extracellular, exosomal, and cell-surface localization, and showed tissue-specific expression in hepatocytes, immune cells, and proximal tubule cells. Significant associations of protein levels with sex (921 proteins), BMI (367 proteins) and age (157 proteins) showed plausible relationships such as prostate-specific antigen and male sex. Unsupervised correlation analysis of protein levels detected multiple biologically meaningful protein clusters, reflecting shared cellular compartments (e.g., lysosomal origin), tissue of origin (e.g., liver), and molecular interactions (e.g., receptor-ligand or chaperone-transporter complexes). In conclusion, the Olink Explore 3072 platform is well-suited for large-scale urine proteomics and identifies biologically plausible representations of ongoing processes in health and disease. Our comprehensive characterization provides a valuable resource for biomarker discovery and future targeted studies of urine proteins. Translational StatementUrinary proteins reflect kidney-specific and systemic processes, with the potential to serve as disease biomarkers. We demonstrate that the Olink Proximity Extension Assay enables high-throughput urine proteome screening with sufficient specificity to identify biologically plausible protein signatures and demographic associations. By providing comprehensive data on protein detectability, variability, and clinical associations, our study serves as a reference resource for designing targeted proteomic investigations, facilitating the development of urine-based biomarker panels for different purposes, potentially including early detection of impaired kidney function, monitoring kidney disease progression, and predicting treatment response.
Solanki, K.; Hu, Y.; Moore, B.; Abedi, V.; Avula, V.; Mirshahi, T.; Regeneron Genetics Center, ; Strande, N.; Bucaloiu, I. D.; Chang, A.
Show abstract
Most data on Alport Syndrome (AS) due to COL4A3 are limited to families with autosomal recessive AS or severe manifestations such as focal segmental glomerulosclerosis (FSGS). Using data from 174,418 participants in the Geisinger MyCode/DiscovEHR study, an unselected health system-based cohort with whole exome sequencing, we identified 403 participants (0.2%) who were heterozygous for likely pathogenic COL4A3 variants. Phenotypic data was evaluated using International Classification of Diseases (ICD) codes, laboratory data, and chart review. To evaluate the phenotypic spectrum of genetically-determined autosomal dominant AS, we matched COL4A3 heterozygotes 1:5 to non-heterozygotes using propensity scores by demographics, hypertension, diabetes, and nephrolithiasis. COL4A3 heterozygotes were at significantly increased risks of hematuria, decreased estimated glomerular filtration rate (eGFR), albuminuria, and end-stage kidney disease (ESKD) (p<0.05 for all comparisons) but not bilateral sensorineural hearing loss (p=0.9). Phenotypic severity tended to be more severe among patients with glycine missense variants located within the collagenous domain. For example, patients with Gly695Arg (n=161) had markedly increased risk of dipstick hematuria (OR 9.47, 95% CI: 6.30, 14.22) and ESKD diagnosis (OR 7.01, 95% CI: 3.48, 14.12) whereas those with PTVs (n=119) had moderately increased risks of dipstick hematuria (OR 1.63, 95% CI: 1.03, 2.58) and ESKD diagnosis (OR 3.43, 95% CI: 1.28, 9.19). Less than a third of patients had albuminuria screening completed, and fewer than 1/3 were taking inhibitors of the renin-angiotensin-aldosterone system (RAASi). Future studies are needed to evaluate the impact of earlier diagnosis, appropriate evaluation, and treatment of ADAS. Significance StatementAlport Syndrome (AS) is the second most common genetic cause of end-stage kidney disease (ESKD), yet little is known about the penetrance and phenotypic spectrum of genetically-determined Autosomal Dominant AS. Using an unselected health system-based cohort, we compared individuals heterozygous for likely pathogenic or pathogenic variants in COL4A3 to a propensity score-matched control group and demonstrate increased risks of hematuria, albuminuria, and ESKD. Risks of kidney disease phenotypes were markedly elevated for missense glycine variants in the collagenous domain and moderately elevated for those with PTVs, compared to controls. The vast majority had not been diagnosed with AS and less than a third ever received albuminuria testing, suggesting opportunities to improve management by early genetic diagnosis.
Nanamatsu, A.; Sabo, A. R.; Barwinska, D.; Bowen, W. S.; Hata, J.; Ferkowicz, M.; Hato, T.; Eadon, M. T.; Dagher, P. C.; Rosenberg, A. Z.; El-Achkar, T. M.; for the Kidney Precision Medicine Project,
Show abstract
BackgroundRenal intratubular casts are frequently observed in the distal nephron segments of the kidney and have long been regarded as a sign of renal disease. However, the composition and pathological significance of intratubular casts have remained understudied. MethodsWe leveraged Hematoxylin and Eosin (H&E) staining to identify intratubular casts along with concurrent Co-detection by indexing (CODEX) multiplexed spatial protein imaging on human kidney biopsy sections from the Kidney Precision Medicine Project (KPMP). We also conducted immunoblotting of Prominin-1 (PROM1) in urine and assessed its levels from publicly available urinary proteomics datasets of the KPMP consortium. ResultsWe analyzed 424 intratubular casts across 33 individuals with kidney disease or healthy controls. We identified PROM1 and IGFBP7 as major constituents of casts (positive staining in 90.1% and 35.6%, respectively). Staining for UMOD, an established cast component, was present in 86.1%. These components exhibited distinct alterations depending on the disease state. Intratubular casts were predominantly detected in the distal nephron segments, and their presence was associated with a marked loss of NCC and AQP2 expression in the cast-containing tubular epithelium, suggesting underlying injury. The loss of these membrane transporters correlated with protein components within casts, and the presence of intra-cast PROM1 showed the strongest association, with an odds ratio of 30.8 (95% confidence interval: 13.4-71.0). Urinary PROM1 secretion was confirmed by immunoblotting and was increased in patients with acute kidney injury (AKI) compared to healthy controls (p = 0.01). ConclusionsWe identified PROM1, a dedifferentiation and injury marker expressed in epithelial cells, as a novel major constituent of intratubular casts. Our studies suggest that protein composition signature within casts varies with disease state and is associated with tubular injury in distal nephron segments. Our study also suggests that urinary PROM1 may serve as a biomarker for AKI. Key Points{checkmark} Utilized CODEX multiplex protein imaging to elucidate the intratubular cast components and the associated tubular alterations. {checkmark}Identified PROM1, a dedifferentiation marker, as a major constituent of intratubular casts. {checkmark}Protein components within casts were altered by disease state and were associated with the injury of the surrounding tubular epithelium.
Sentell, Z. T.; Russo, F.; Henein, M.; Mougharbel, L.; Nurcombe, Z. W.; Alam, A.; Baran, D.; Bell, L. E.; Blum, D.; Cantarovich, M.; Cybulsky, A. V.; De Chickera, S.; Downie, M. L.; Foster, B. J.; Frisch, G.; Goodyer, P. R.; Gupta, I. R.; Horowitz, L.; Lemay, S.; Lipman, M. L.; Nessim, S. J.; Podymow, T.; Samanta, R.; Sandal, S.; Suri, R.; Takano, T.; Trinh, E.; Vasilevsky, M.; Sapir-Pichhadze, R.; Kitzler, T. M.
Show abstract
BackgroundChronic kidney disease (CKD) affects over 10% of the global population. A genetic diagnosis can be identified in about 30% of pediatric and 10-30% of adults, informing treatment, prognosis, and family-based risk assessment. However, access to renal genetics services remains limited across many healthcare systems. ObjectivesTo characterize the clinical and genetic landscape of CKD in patients referred for genetic evaluation within a Canadian single-centre nephrology-genetics program, and to evaluate the diagnostic yield and clinical utility of an integrated renal genetics clinic. MethodsWe conducted a retrospective study of 206 probands referred for suspected hereditary kidney disease to the McGill University Health Centre Renal Genetics Clinic between 2019 and 2024. Genetic testing was performed in accredited laboratories, predominantly through comprehensive multi-gene panels or phenotype-directed exome sequencing. All reported variants were classified according to the ACMG/AMP criteria, and variants of uncertain significance were reevaluated post hoc using standardized quantitative and evidence-tier frameworks to determine whether they trended toward "likely pathogenic" ("hot") or "likely benign" ("cold"), without implying formal reclassification. ResultsA molecular diagnosis was established in 34.5% of probands (71/206), implicating pathogenic or likely pathogenic variants across 35 genes representing diverse monogenic kidney disease etiologies. The highest diagnostic yields were observed in cystic nephropathy (51.9%), tubulopathy (38.5%), and glomerulopathy (35.6%). Genetic results affected clinical management in 23.9% of diagnosed cases, leading to changes in treatment for 16.9%, modification of transplant management in 5.6%, informed living donor risk assessment in 14.1%, and facilitated cascade testing in 66.2% of families. CKD of unknown etiology comprised 28% of the cohort, with a genetic diagnosis reached in 25.9% of these cases. Variants of uncertain significance (VUS) were reported in 39.3% of probands, with higher overall variant burden and lower diagnostic yields among individuals of non-European ancestry. Post hoc internal reassessment stratified 67.7% of VUS as mid or lower confidence ("cold") and 32.2% as higher confidence ("hot") or likely pathogenic. ConclusionsIn a diverse urban population, integration of a dedicated renal genetics service within nephrology care achieved high diagnostic yield, substantially influenced management, and facilitated family risk assessment. Structured referral pathways and multidisciplinary variant interpretation optimize the clinical utility of genetic testing in CKD.
Mariani, L. H.; Eddy, S.; Alakwaa, F. M.; McCown, P. J.; Harder, J. L.; Martini, S.; Ademola, A. D.; Boima, V.; Reich, H. N.; Eichinger, F.; El Saghir, J.; Godfrey, B.; Ju, W.; Nair, V.; Tanner, E. C.; Vega-Warner, V.; Wys, N. L.; Adler, S. G.; Appel, G. B.; Athavale, A.; Atkinson, M. A.; Bagnasco, S. M.; Barisoni, L.; Brown, E.; Cattran, D. C.; Dell, K. M.; Derebail, V. K.; Fervenza, F.; Fornoni, A.; Gadegbeku, C. A.; Gibson, K. L.; Greenbaum, L. A.; Hingorani, S. R.; Hladunewich, M. A.; Hodgin, J. B.; Hogan, J. J.; Hogan, M.; Holzman, L. B.; Jefferson, A. J.; Kaskel, F. J.; Jeffrey, K. B.; L
Show abstract
BackgroundClassification of nephrotic syndrome relies on clinical presentation and descriptive patterns of injury on kidney biopsies. This approach does not reflect underlying disease biology, limiting the ability to predict progression or treatment response. MethodsSystems biology approaches were used to categorize patients with minimal change disease (MCD) and focal segmental glomerulosclerosis (FSGS) based on kidney biopsy tissue transcriptomics across three cohorts and assessed association with clinical outcomes. Patient-level tissue pathway activation scores were generated using differential gene expression. Then, functional enrichment and non-invasive urine biomarker candidates were identified. Biomarkers were validated in kidney organoid models and single nucleus RNA-seq (snRNAseq) from kidney biopsies. ResultsTranscriptome-based categorization identified three subgroups of patients with shared molecular signatures across independent North American, European and African cohorts. One subgroup demonstrated worse longterm outcomes (HR 5.2, p = 0.001) which persisted after adjusting for diagnosis and clinical measures (HR 3.8, p = 0.035) at time of biopsy. This subgroups molecular profile was largely (48%) driven by tissue necrosis factor (TNF) activation and could be predicted based on levels of TNF pathway urinary biomarkers TIMP-1 and MCP-1 and clinical features (correlation 0.63, p <0.001 for predicted vs observed score). Kidney organoids confirmed TNF-dependent increase in transcript and protein levels of these markers in kidney cells, as did snRNAseq from NEPTUNE biopsy samples. ConclusionsMolecular profiling identified a patient subgroup within nephrotic syndrome with poor outcome and kidney TNF pathway activation. Clinical trials using non-invasive biomarkers of pathway activation to target therapies are currently being evaluated. Significance StatementMechanistic, targeted therapies are urgently needed for patients with nephrotic syndrome. The inability to target an individuals specific disease mechanism using currently used diagnostic parameters leads to potential treatment failure and toxicity risk. Patients with focal segmental glomerulosclerosis (FSGS) and minimal change disease (MCD) were grouped by kidney tissue transcriptional profiles and a subgroup associated with poor outcomes defined. The segregation of the poor outcome group was driven by tumor necrosis factor (TNF) pathway activation and could be identified by urine biomarkers, MCP1 and TIMP1. Based on these findings, clinical trials utilizing non-invasive biomarkers of pathway activation to target therapies, improve response rates and facilitate personalized treatment in nephrotic syndrome have been initiated.
Schnobrich, L.; de Hesselle, H. C.; Mornhinweg, L.; Felgner, R.; Zimmermann, M. E.; Brandl, C.; Heid, I. M.; Castrop, H.; Stark, K. J.
Show abstract
BackgroundProgression into more severe stages of chronic kidney disease (CKD) based on estimated glomerular filtration rate (eGFR) and albuminuria are associated with increased risk of end-stage renal failure, cardiovascular diseases, and mortality. Vesicles in the urine are cell-derived particles containing constituents of the cells of origin. Little is known about the prognostic capacity of urinary vesicles for CKD progression. PurposeTo evaluate the association between components of urinary vesicles and incident CKD. MethodsIn the AugUR study, a prospective population-based cohort study in individuals aged 70-95 years at baseline, we isolated and characterized urinary vesicles from 580 participants at two timepoints. In cross-sectional data, influences of age, sex and established kidney biomarkers on vesicular albumin and podocalyxin were characterised. Longitudinal data were used to test associations of vesicular albumin and podocalyxin with incident eGFR-based CKD and albuminuria. ResultsCross-sectionally, urinary vesicle albumin and urinary vesicle-bound podocalyxin were moderately correlated with each other and with urinary albumin and alpha1-microglobulin, but not with eGFR. Vesicular albumin concentrations were influenced by sex, whereas age showed an effect on podocalyxin. After adjusting for age and sex, higher vesicular albumin was associated with higher urinary albumin and lower eGFR. Higher vesicular podocalyxin concentrations were associated with higher urinary albumin but not with eGFR. Both markers showed identical associations with urinary alpha1-microglobulin. In longitudinal analyses, baseline vesicular albumin showed association with incident CKD based on eGFR. This association was no longer present after adjustment for baseline eGFR. In contrast, higher baseline podocalyxin concentrations were predictive for decreased risk of incident albuminuria after adjustment for baseline free urinary albumin. Baseline-adjusted change in urinary vesicle albumin and urinary vesicle-bound podocalyxin were both associated with incident albuminuria, independent of free urinary albumin and other kidney biomarkers. Here, increase in follow-up versus baseline values were associated with higher risk for incident albuminuria, with higher effect sizes for vesicular albumin. ConclusionThis study indicates that higher vesicular podocalyxin at baseline might be a potential predictor for lower risk for albuminuria over three years in an old-aged cohort. In contrast, longitudinal increase in urinary vesicle biomarkers, especially vesicular albumin, might be diagnostic markers for incident albuminuria in the elderly. KEY MessagesWhat is known O_LIAccording to a previous study in animals, accumulation of albumin in the subpodocyte space leads to subsequent endocytosis by the podocytes. C_LIO_LIPodocyte-produced vesicles contain potential biomarkers of the deterioration of kidney function in humans. C_LI What is new O_LIBiomarkers from urinary vesicles can be quantified from biobanked human samples. C_LIO_LIHigher vesicular podocalyxin at baseline might be a potential predictor for lower risk for albuminuria over three years in an old-aged cohort. C_LIO_LIChanges in urinary vesicle biomarkers over time, especially vesicular albumin, are associated with incident albuminuria independent of eGFR and free urinary albumin. C_LI
Chan, M. M.; Sadeghi-Alavijeh, O.; Voinescu, C.; van der Zanden, L.; Groen in 't Woud, S.; Schreuder, M.; Feitz, W.; Mingardo, E.; Hilger, A.; Reutter, H.; Vendrig, L.; Westland, R.; Stanescu, H.; Levine, A.; Bockenhauer, D.; Gale, D. P.
Show abstract
IntroductionCongenital anomalies of the kidneys and urinary tract (CAKUT) are the commonest cause of kidney failure in children and young adults. Over 50 monogenic causes have been identified, however less than 20% of patients have a genetic diagnosis identified using targeted or whole exome sequencing. We sought to characterise the genomic architecture of CAKUT using whole genome sequencing (WGS). MethodsUsing WGS from 1,052 unrelated individuals with CAKUT recruited to the UKs 100,000 Genomes Project, we determined diagnostic yield and looked for gene-based enrichment of rare variants exome-wide. We performed sequencing based genome-wide association studies (seqGWAS) and used these results to estimate the heritability explained by common variants. ResultsThe overall diagnostic yield was 4.9% with family history (P=0.02; OR 2.2; 95% CI 1.1-4.4), consanguinity (P=0.01; OR 3.0; 95%CI 1.2-6.9) and extra-renal features (P=1.1x10-4; OR 3.1; 95% CI 1.7-5.7) independently predicting a monogenic diagnosis. Diagnostic yield was highest in cystic kidney dysplasia (11.1%) and kidney agenesis/hypodysplasia (7.4%). Exome-wide rare variant and genome-wide common variant (minor allele frequency [MAF] [≥] 0.5%) association testing in a subset of 813 patients and 25,205 ancestry-matched controls identified significant association at 6q16.3 (rs117473527; P=4.83x10-8; OR 3.13; 95% CI 2.08-4.72; MAF 0.01) which requires replication. Common variants were estimated to explain up to 23% of the phenotypic variance observed in CAKUT in those with European ancestry suggesting that larger studies are needed to recover some of this missing heritability. A genomic risk score for posterior urethral valves was also validated in an independent European cohort of 77 cases and 2,746 controls (P<0.001). ConclusionsOnly a minority of patients in this large, unselected cohort received a monogenic diagnosis, with common variants estimated to account for a substantial proportion of phenotypic heritability. This suggests that non-Mendelian genomic factors may be important for the pathogenesis of CAKUT. Lay SummaryThis study shows that single-gene causes of isolated and non-familial CAKUT are rare, and that genomic testing should be targeted towards those with kidney cysts and/or small kidneys that have not formed properly in the womb. Individuals with a close relative with CAKUT and those with involvement of other organ systems were more likely to receive a genetic diagnosis. These data support a possible polygenic basis for CAKUT, where many common DNA changes cumulatively affect risk, particularly in posterior urethral valves, the most common cause of kidney failure in boys. Larger collaborative genomic studies are needed to increase our ability to identify these DNA changes and the mechanisms and pathways important for kidney and urinary tract development.
Sadeghi-Alavijeh, O.; Chan, M. M.; Tzoumkas, K.; Doctor, G. T.; Gale, D. P.
Show abstract
BackgroundUnexplained kidney failure (uKF) affects 15% of individuals requiring kidney replacement therapy. Absence of a diagnosis creates uncertainty around recurrence after transplantation, familial risk, and participation in therapeutic trials. Whole genome sequencing (WGS) was used to identify genetic variants contributing to uKF. Methods218 patients who presented with uKF < 50 years old were recruited to the UKs 100,000 Genomes Project. Candidate variants in 183 genes were reviewed for pathogenicity by a multidisciplinary team. Gene-based association testing, structural variant analyses, and assessment of high-risk APOL1 genotypes were performed. Polygenic risk scores (PRS) were calculated for chronic kidney disease (CKD), and various glomerulonephritides. HLA associations in those with APOL1 high-risk genotype were also investigated. ResultsA positive genetic diagnosis was made in 17% (38/218) of patients. The median age of uKF onset was 36 years. Fewer genetic diagnoses were found in those aged [≥] 36 years compared to younger individuals, both with (11% vs. 35%, P=0.03) and without (5% vs. 19%, P=0.05) a family history. Three patients [≥] 36 years without a family history had pathogenic variants in type IV collagen genes. High-risk APOL1 genotypes were enriched in patients with recent African ancestry (52% vs 8.4%, P=5.97x10-8). Dividing the uKF cohort by subsequent identification of monogenic diagnosis, High-risk APOL1 genotype, or neither, we found that the SSNS PRS was higher in those with High-risk APOL1 (P=0.048), driven by differences at HLA-DQB1*03:19 (P=0.001). ConclusionsThese findings estimate the likelihood of a genetic diagnosis using WGS in uKF patients, showing fewer diagnoses in older patients without a family history. APOL1 contributes significantly to uKF in those with recent African ancestry, potentially interacting with HLA-DQB1. The lack of PRS signal for CKD suggests distinct biology between uKF and more common causes of CKD.
Chang, A.; Moore, B. S.; Luo, J. Z.; Sartori, G. A.; Fang, B.; Jacobs, S. A.; Abdalla, Y.; Taher, M. F.; Regeneron Genetics Center, ; Triffo, W.; Singh, G.; Mirshahi, T.
Show abstract
ImportanceMost studies of ADPKD genetics have used select cohorts, focusing on PKD1 and PKD2 and more recently several other cystic genes. However, the population prevalence of ADPKD and the contribution of each cystic gene to ADPKD are not well understood. ObjectiveDetermine the prevalence of ADPKD, contribution of PKD1, PKD2, and other cystic genes to ADPKD in a large, unselected cohort. Design, Setting, and ParticipantsWe determined the prevalence of ADPKD In an unselected health system-based cohort of 173,954 subjects with the existing exome sequencing and extensive electronic health records, including abdominal imaging. The presence of genetic variants in PKD1, PKD2, and eleven other cystic genes was evaluated. Rare genetic variants were identified in patients with chart review confirmed diagnosis of ADPKD. Main OutcomesDiagnosis of ADPKD and presences of rare (AF<0.0001) missense, protein-truncating variants (PTVs), or copy number variants deletions (CNV) in PKD1, PKD2, or PTVs and CNVs in the following 11 genes: ALG8, ALG9, DNAJB11, GANAB, HNF1B, IFT140, LRP5, PKHD1, PRKCSH, SEC61B, and SEC63. ResultsAmong 173,954 patients, there were 235 patients with chart review confirmed ADPKD (0.135%). Among patients with PTV or CNV in PKD1, 66/70 (94.2%) had ADPKD and 43/44 (97.7%) of patients with PTV or CNV in PKD2 had ADPKD. In contrast, only 24/77 (31.2%) patients with a PKD1 missense variant previously classified as "likely pathogenic" had ADPKD. A rare variant was identified in a cystic gene in 180/235 (76.6%) of ADPKD patients, with the most common genes implicated PKD1 (127) and PKD2 (34) and then IFT140 (7), PKHD1 (3), GANAB (4), HNF1B (2), ALG8 (1), ALG9 (1), IFT140+PKHD1 (1). The yield for a genetic determinant of ADPKD was 91.3% among those with a family history compared to 50.6% among those without a family history (p<0.0001). We report several previously unreported variants where pedigree data suggest pathogenicity. Atypical cystic genes ALG8, ALG9, GANAB, HNF1B, IFT140, and SEC63 were associated with having any kidney or liver cystic ICD code, but not diagnosed ADPKD. ConclusionsExome sequencing established the molecular diagnosis for the vast majority of patients with ADPKD, revealed a wider range of ADPKD with atypical cystic genes. Additional population-based research cohorts are needed to carefully curate missense PKD1 variants and variants in atypical cystic genes.
Masoud, S.; Wong, K.; Downward, L.; Pitcher, D.; Webb, N. J. A.; Proudfoot, C.; RaDaR Consortium, ; Wong, E. K. S.; Gale, D. P.
Show abstract
BackgroundC3 glomerulopathy (C3G) and immune-complex membranoproliferative glomerulonephritis (IC-MPGN) are rare disorders that frequently result in kidney failure over the long-term. At present, there are no disease-specific treatments approved for these disorders, although there is much interest in the therapeutic potential of complement inhibition. However, the limited duration and necessarily small size of controlled trials means there is a need to quantify how well short-term changes in eGFR and proteinuria predict the clinically important outcome of kidney failure. We aimed to address this using longitudinal data from the UK National Registry of Rare Kidney Diseases (RaDaR). MethodsRaDaR involves both retrospective and prospective data collection with linkage to hospital laboratories via automated feeds. 667 patients were included. Analyses of kidney survival were conducted using Kaplan-Meier and Cox regression. eGFR slope was estimated using linear mixed models. ResultsOver a median of 10.1 (IQR 6.9-14.3) years follow-up, 253/667 (38%) reached kidney failure. There was no difference in progression to kidney failure between C3G, IC-MPGN and Primary MPGN Not Otherwise Specified subgroups (p=0.75). Baseline urine protein creatinine ratio (UPCR), although high, was not associated with kidney failure risk. 2-year eGFR slope had a modest effect on kidney failure risk. In contrast, both 20-50% and 0.44g/g (50mg/mmol) reductions in time-averaged UPCR at 12 months were strongly associated with lower kidney failure risk (p[≤]0.002). Most notably, those with a UPCR <0.88g/g (<100mg/mmol) at 12 months had a substantially lower risk of kidney failure (HR 0.15 (95%CI 0.05-0.41). ConclusionsWe quantified the relationships between early changes in both eGFR and proteinuria with long-term kidney survival. We demonstrate that proteinuria a short time after diagnosis is a strong predictor of long-term outcome and that a UPCR <0.88g/g (<100mg/mmol) at 1 year is associated with a substantially lower kidney failure risk.
Caplin, B.; Agarwal, S.; Day, A.; Al-Rashed, A.; Oomatia, A.; Gonzalez-Quiroz, M.; Pearce, N.
Show abstract
IntroductionThere remains considerable debate as to the cause of the epidemic of Mesoamerican Nephropathy (MeN). We have previously reported early loss of estimated glomerular filtration rate (eGFR) as a surrogate for disease onset in a population-representative cohort study of young-adults at risk of disease from Northwest Nicaragua. Using a nested case-control approach we analysed urine and serum proteins surrounding this timepoint with the aim of gaining insight into the primary disease aetiology. MethodsWe conducted label-free ultra high-performance liquid chromatography mass-spectrometry based proteomics using urine samples collected at the study visit before, and at, first observed eGFR loss amongst cases and compared results to matched controls. We then performed direct protein measurements in a discovery cohort followed by quantification of serum total immunoglobulin E (stIgE) at multiple timepoints in a replication cohort. ResultsProteomic analysis demonstrated no differences in the levels of any single protein between cases and controls (n=25 each), at either timepoint, after correction for multiple comparisons. However, functional enrichment analysis demonstrated upregulation of adaptive immune pathways amongst cases. Direct measurements in the discovery cohort using high-sensitivity PCR-based immunoassay (n=21 controls, 19 cases) demonstrated higher stIgE in cases at the study visit immediately prior to first observed eGFR loss (mean difference 810kU/L, 95% confidence interval (CI): 162-1457kU/L). In the replication cohort (n=22 cases, 21 controls) an stIgE level >500kU/L measured by electrochemiluminescence in study samples from any timepoint in the 3 years prior to the first observed loss of eGFR was independently associated with case status when compared to samples from controls at matched visits (adjusted Odds Ratio: 8.1, 95% CI: 1.4-47.8). DiscussionA high level of stIgE precedes loss of eGFR in those at risk of MeN. Understanding what leads to this rise is likely to be key to understanding the cause of the MeN epidemic. Lay SummaryMesoamerican nephropathy describes an epidemic-level chronic kidney disease impacting rural working age adults in Central America. Although a number of exposures, including occupational heat exposure, have been proposed the cause of the epidemic, there remains much debate as to the primary aetiology of the disease. In this study we interrogated urine and blood samples from individuals from affected communities at risk of disease both before and after they develop kidney dysfunction. Using two different approaches, analysis of both urine and blood samples provide evidence of upregulation of immunoglobulin-E (IgE) related pathways in the 2-3 years before individuals develop evidence of kidney disease. Infections (particularly those involving parasites) and allergic reactions, but not heat exposure, have been reported to increase IgE levels. Going forwards, understanding the cause of this increase in IgE in individuals at risk of disease is likely to provide insight into the cause of Mesoamerican Nephropathy epidemics.
Zellers, M.; Solanki, K.; Retterer, K.; Murphy, K.; Kelly, M.; Kirchner, H. L.; Bucaloiu, I. D.; Mirshahi, T.; Moore, B.; Chang, A. R.
Show abstract
IntroductionOur knowledge of X-linked Alport Syndrome [AS] comes mostly from selected cohorts with more severe disease. MethodsWe examined the phenotypic spectrum of X-linked AS in males and females with a genotype-based approach using data from the Geisinger MyCode DiscovEHR study, an unselected health system-based cohort with exome sequencing and electronic health records. Patients with COL4A5 variants reported as pathogenic (P) or likely pathogenic (LP) in ClinVar, or protein-truncating variants (PTVs), were each matched with up to 5 controls without COL4A3/4/5 variants by sociodemographics, diabetes diagnosis, and year of first outpatient encounter. AS-related phenotypes included dipstick hematuria, bilateral sensorineural hearing loss (BSHL), proteinuria, decreased eGFR, and ESKD. ResultsOut of 170,856 patients, there were 29 hemizygous males (mean age 52.0 y [SD 20.0]) and 55 heterozygous females (mean age 59.3 y [SD 18.8]) with a COL4A5 P/LP variant, including 48 with the hypomorphic variant p.Gly624Asp. Overall, penetrance (having any AS phenotypic feature) was highest for non-p.Gly624Asp P/LP variants (males: 94%, females: 85%), intermediate for p.Gly624Asp (males: 77%, females: 69%), compared to controls (males: 32%; females: 50%). The proportion with ESKD was highest for males with P/LP variants (44%), intermediate for males with p.Gly624Asp (15%) and females with P/LP variants (10%), compared to controls (males: 3%, females 2%). Only 47% of individuals with COL4A5 had completed albuminuria screening, and a minority were taking renin-angiotensin aldosterone system (RAAS) inhibitors. Only 38% of males and 16% of females had a known diagnosis of Alport syndrome or thin basement membrane disease. ConclusionIn an unselected cohort, we show increased risks of AS-related phenotypes in men and women compared to matched controls, while showing a wider spectrum of severity than has been described previously and variability by genotype. Future studies are needed to determine whether early genetic diagnosis can improve outcomes in Alport Syndrome.
Sadeghi-Alavijeh, O.; Chan, M. M.; Doctor, G.; Voinescu, C.; Stuckey, A.; Kousathanas, A.; Ho, A.; Genomics England Research Consortium, ; Stanescu, H.; Stanescu, H.; Bockenhauer, D.; Sandford, R.; Levine, A. P.; Gale, D. P.
Show abstract
Cystic kidney disease (CyKD) is a predominantly familial disease. Gene discovery has been led by family-based and candidate gene studies, limiting the ascertainment of additional genome-wide variants involved. Taking whole genome sequencing data from the 100,000 Genomes Project, we used hypothesis-free approaches to systematically characterize and quantify genetic contributors to CyKD across variant types and the allelic spectrum in 1,209 cases and 26,096 ancestry-matched controls. In 82.3% CyKD cases a likely disease-causing monogenic variant was identified. There was an enrichment of rare coding, splicing and structural variants in known CyKD genes, and novel gene-based signals in COL4A3 and (monoallelic) PKHD1. The risks of these variants to CyKD were quantified, with lower risk seen in more recently described genes. Meta-analysis of common variants across four international biobanks did not reveal any associations. Common variants accounted for 3-9% of the heritability of CyKD across three European ancestry cohorts. This represents an unbiased examination of the genetic architecture of a national CyKD cohort using robust statistical methodology. We have quantified the contribution of coding, non-coding, and structural variants to CyKD, and the small contribution of common variants to its heritability. These findings will inform genetic testing and counselling strategies in the clinic.
Malijan, G. B.; Chapman, D.; Moffat, S.; Sardell, R.; Staplin, N.; Landray, M. J.; Baigent, C.; Shlipak, M. G.; Haynes, R.; Ix, J. H.; Herrington, W. G.; Hill, M.; Judge, P. K.
Show abstract
Sodium-glucose co-transporter 2 (SGLT2) inhibitors are recommended for use in adults with chronic kidney disease (CKD) and are widely prescribed. SGLT2 inhibition markedly increases urine glucose excretion, which could interfere with laboratory assays. We assessed whether assays for several key urine tubular biomarkers (alpha-1 microglobulin [1M], dickkopf-3 [DKK-3], epidermal growth factor [EGF], interleukin-18 [IL-18], kidney injury molecule-1 [KIM-1], monocyte chemoattractant protein-1 [MCP-1], neutrophil gelatinase-associated lipocalin [NGAL], uromodulin [UMOD], and human cartilage glycoprotein-40 [YKL-40]) are affected by glycosuria using urine samples from participants with CKD. Each urine sample was divided into three aliquots, with one serving as control and the other two being spiked with glucose to reach effective concentrations of 28 mmol/l and 111 mmol/l. There was large positive mean bias [95% CI] observed at 28 mmol/l glucose concentration for IL-18 (0.10 [0.01, 0.23]) and YKL-40 (0.40 [0.32, 0.49]). The limits of agreement (LOA) for both biomarkers were wide, spanning >1 unit difference in log-transformed biomarker values. The rest of the biomarkers had narrow LOA. Modest negative mean bias at 28 mmol/l glucose concentration was observed for DKK-3 (-0.02 [-0.04, 0]), KIM-1 (-0.04 [-0.06, -0.02]), and UMOD (-0.08 [-0.11, -0.06]), with similar values observed at 111 mmol/l glucose concentration. There was no evidence of any bias in measurements of 1M, EGF, MCP-1, and NGAL. Glycosuria substantially interferes with IL-18 and YKL-40 measurements, without importantly affecting 1M, DKK-3, EGF, KIM-1, MCP-1, NGAL or UMOD.
Neumann, C.; Bloos, F.; Hla, T. T. W.; Bygott, T.; Bogatsch, H.; Kiehntopf, M.; Borner, F.; Press, A. T.; Bauer, M.; Retter, A.
Show abstract
BackgroundNETosis is a key innate immune defence mechanism where neutrophils release extracellular traps (NETs). However, excessive NET formation may damage organs during sepsis. We investigated the association between NETs and sepsis outcomes, including mortality and acute kidney injury (AKI). MethodsWe analysed levels of H3.1 nucleosomes in 971 patients with severe sepsis and septic shock from the SISPCT trial (Effect of Sodium Selenite Administration and Procalcitonin-Guided Therapy on Mortality in Patients With Severe Sepsis or Septic Shock). We evaluated associations between H3.1 levels and mortality and the need for renal replacement therapy using multivariable Cox regression and receiver operating characteristic analyses. ResultsWe analysed 971 critically ill patients with complete data including admission H3.1 levels. 443 patients (45.6%) presented with sepsis, 520 (53.6%) had septic shock, and eight patients had an unknown diagnosis as defined by Sepsis-3. Admission H3.1 levels were higher in patients with septic shock than with sepsis (median 921.84 vs 432.71 ng/mL; p<0.001). Admission H3.1 levels were higher in non-survivors, and in a univariate Cox analysis, each log-10 increase in H3.1 was associated with a hazard ratio of 1.86 (95% confidence interval 1.41-2.47, p<0.05). H3.1 was also higher in patients requiring renal replacement therapy with septic shock vs sepsis (1832 ng/mL vs 801.4 ng/mL, p=0.01) and demonstrated a dose-response relationship with the severity of AKI. ConclusionElevated levels of H3.1 nucleosomes at admission are independently associated with mortality and severe kidney dysfunction requiring renal replacement therapy. Trial registrationClinicaltrials.gov Identifier, NCT00832039.
Gill, D.; Zagkos, L.; Gill, R.; Benzing, T.; Jordan, J.; Birkenfeld, A.; Burgess, S.; Zahn, G.
Show abstract
BackgroundSolute carrier family 13 member 5 (SLC13A5) is a Na -coupled citrate co-transporter that mediates the entry of extracellular citrate into the cytosol. SLC13A5 inhibition has been proposed as a therapeutic target for reducing progression of kidney disease via its effects on citrate metabolism. However, evidence of its efficacy in humans is limited. The aim of this study was to leverage the Mendelian randomization paradigm to gain insight into the effects of SLC13A5 inhibition in humans, towards prioritizing and informing clinical development efforts. MethodsThe primary Mendelian randomization analyses investigated the effect of SLC13A5 inhibition on measures of kidney function, including creatinine and cystatin C based measures of estimated glomerular filtration rate (creatinine-eGFR and cystatin C-eGFR), blood urea nitrogen (BUN), urine albumin-creatinine ratio (uACR), and risk of chronic kidney disease and microalbuminuria. Secondary analyses included a paired plasma and urine metabolome-wide association study, investigation of secondary traits related to SLC13A5 biology, a phenome-wide association study (PheWAS), and a proteome-wide association study. All analyses were compared to the effect of genetically predicted plasma citrate levels using variants selected from across the genome, and statistical sensitivity analyses robust to the inclusion of pleiotropic variants were also performed. Data were obtained from large scale genetic consortia and biobanks, with sample sizes ranging from 5,023 to 1,320,016 individuals. ResultsWe found evidence of associations between genetically proxied SLC13A5 inhibition and higher creatinine-eGFR (p=0.002), cystatin C-eGFR (p=0.005), and lower BUN (p=3x10-3). Statistical sensitivity analyses robust to the inclusion of pleiotropic variants suggested that these effects may be a consequence of higher plasma citrate levels. There was no strong evidence of associations of genetically proxied SLC13A5 inhibition with uACR or risk of CKD or microalbuminuria. Secondary analyses also identified evidence of associations with higher plasma calcium levels (p=6x10-13) and lower fasting glucose (p=0.02). PheWAS did not identify any safety concerns. ConclusionThis Mendelian randomization analysis provides human-centric insight to guide clinical development of an SLC13A5 inhibitor. We identify plasma calcium and citrate as biologically plausible biomarkers of target engagement, and plasma citrate as a potential biomarker of mechanism of action. Our human genetic evidence corroborates evidence from various animal models to support effects of SLC13A5 inhibition on improving kidney function. Further study in the form of early-stage clinical trials may now be warranted to help translate these findings towards improving patient care.
DEVI, C.; Singh, S.; Mohapatra, B.; Kumar, A.; Vikrant, S.; Singh, R. G.; Das, P.
Show abstract
Autosomal Dominant Polycystic Kidney Disease is characterized by renal cyst development, often leading to kidney enlargement and failure. We conducted whole exome sequencing on 14 participants (12 families) from an Indian cohort. Our analysis revealed a spectrum of genetic variants, predominantly in the PKD1. These in PKD1 included missense variants such as p.Glu2937Lys (c.8809G>A) and p.Gly2310Arg (c.6928G>A), p.Asp2095Gly (c.6284A>G), p.Thr938Met (c.2813C>T), p.Trp967Arg (c.2899T>C), p.Glu593* (c.1777G>T), frameshift variants p.Gln149fs*141 (c.445delC), p.Ser3305fs*84 (c.9914_9915delCT), p.His1347fs*83 (c.4041_4042delCA), and p.Leu2776fs*87(c.8327_8363delTGGCGGGCGAGGAGATCGTGGCCCAGGGCAAGCGCTC), intronic splice site variant c.8017-3C>G, nonsense variant p.Glu593* (c.1777G>T) and in PKD2 missense variant p.Ser370Asn (c.1109G>A). While one individual carried intronic (c.2358+5G>A) and 3UTR (c.*174G>T) variants in PKD2 only another individual carried variants in both PKD1 and PKD2, suggesting potential genetic complexity. Clinical data revealed diverse presentations. Age at diagnosis varied widely. Patients with frameshift variants exhibited earlier onset and severe manifestations, including bilateral ADPKD. One proband had right unilateral ADPKD. Involvement of liver, a common extra-renal manifestation, was also observed. Heterogeneity at phenotypic and at allelic level was observed in our cohort. In this study, using WES of a trio, a frameshift-truncation deletion [c.32del/p.Leu11ArgfsTer61] in MIOX was found to be associated with the disease shared by both the affected and early diagnosed mother and daughter carrying PKD1 missense variant, which had not been previously reported in ADPKD. Further, differential gene expression analysis using data from GEO database showed reduced MIOX expression in ADPKD cystic samples compared to minimal cystic tissues and controls. MIOX is an enzyme specific to renal tubules and catalyses the initial step of the kidney-based myoinositol catabolism. Both affected candidates also shared benign variants and other variations of uncertain significance which may influence the disease development. Further functional analysis will clarify how MIOX contributes to the disease. The study limitations include the small sample size and the need for validation in larger cohorts. Our findings highlight the importance of genetic analysis in ADPKD management especially to facilitate personalized therapeutic strategies. HighlightsO_LIIdentified variants in PKD1 and PKD2 through whole exome sequencing in ADPKD patients, affecting different protein regions. C_LIO_LIVariants include non-synonymous coding changes, frame-shift deletions, and splice site alterations. C_LIO_LIClinical features and age at diagnosis varied widely, with common symptoms including flank pain, fatigue. C_LIO_LIFrameshift deletion in MIOX, associated in one PKD1 trio, implicates its role in ADPKD pathogenesis. C_LIO_LIDGE analysis of dataset from database reveals downregulation of MIOX in ADPKD tissue samples highlighting its role in potential molecular pathways in ADPKD progression. C_LI Graphical abstract O_FIG O_LINKSMALLFIG WIDTH=200 HEIGHT=117 SRC="FIGDIR/small/23288719v2_ufig1.gif" ALT="Figure 1"> View larger version (54K): org.highwire.dtl.DTLVardef@8b0229org.highwire.dtl.DTLVardef@3af2d9org.highwire.dtl.DTLVardef@1db8feorg.highwire.dtl.DTLVardef@15c4045_HPS_FORMAT_FIGEXP M_FIG C_FIG
Sadeghi-Alavijeh, O.; Chan, M.; Moochhala, S.; Genomics England Research Consortium, ; Howles, S. A.; Gale, D.; Bockenhauer, D.
Show abstract
Urinary stone disease (USD) is a major health burden affecting >10% of the UK population at some time. While stone disease is strongly associated with lifestyle, genetic factors also predispose to USD: common genetic variants at multiple loci from genome-wide association studies account for 5% of the estimated 45% heritability of the disorder. We investigated the extent to which rare genetic variation contributes to the unexplained heritability of USD. Among participants of the UK 100,000 genome project, we identified 374 unrelated individuals assigned diagnostic codes indicative of USD. We performed whole genome gene-based variant burden testing and polygenic risk scoring against a control population of 24,930 genetic ancestry matched controls. We observed (and replicated in an independent dataset) exome-wide significant enrichment (P=2.61x10-07) of monoallelic rare, predicted damaging variants in SLC34A3 (previously associated with autosomal recessive hereditary hypophosphataemic rickets with hypercalciuria) present in 19 (5%) cases compared with 1.6% of controls. The risk of USD with a monoallelic SLC34A3 variant (OR=3.75, 95% CI 2.27-5.91) was greater than the top decile of polygenic risk (OR=2.31, 95% CI 1.12-3.51). Addition of the SLC34A3 variant binary to a linear model including polygenic score increased the estimated variance explained, increasing the liability adjusted pseudo-R2 from 5.1% to 14.2%. We also observed significant association at OR9K2, an olfactory receptor, but this signal was not replicated. In this cohort rare variants in SLC34A3 were the most important genetic risk factor for USD, with levels of pathogenicity intermediate between the fully penetrant rare variants linked with Mendelian disorders and the weaker effects of common variants associated with USD. These findings explain some of the heritability unexplained by prior common variant GWAS.
Kujat, J.; Langhans, V.; Brand, H.; Freund, P.; Goerlich, N.; Wagner, L.; Metzke, D.; Timm, S.; Ochs, M.; Gruetzkau, A.; Baumgart, S.; Skopnik, C. M.; Hiepe, F.; Riemekasten, G.; Klocke, J.; Enghard, P.
Show abstract
IntroductionAcute kidney injury (AKI) is associated with significant morbidity and mortality. The diagnosis is currently based on urine output and serum creatinine and there is a lack of biomarkers that directly reflect tubular damage. Here, we establish flow cytometric quantification of renal epithelial cells as a potential biomarker for quantifying the severity of tubular kidney damage and for predicting AKI outcome. MethodsA total of 84 patients with AKI were included in this study, divided into an exploratory cohort (n=21) and confirmatory cohort (n=63), as well as 25 controls. Urine of patients was collected and processed within 72 hours after AKI onset. Different urinary tubular epithelial cell (TEC) populations were identified and quantified by flow cytometry (FACS). Urinary cell counts were analyzed regarding AKI severity defined by KDIGO stage as well as renal recovery, length of hospital stay and occurrence of MAKE-30 events. ResultsUrinary TEC counts correlated with stages of AKI based on KDIGO classification and were significantly enriched in patients with AKI compared to healthy donors and inpatient controls in both cohorts. Furthermore, both proximal and distal TEC (pTEC, dTEC) counts performed well in identification of patients with AKI regardless of stage. Urinary amounts of pTEC and dTEC showed a strong correlation, with predominance of dTEC. Higher numbers of TEC were associated with extended length of hospital stay, while elevated pTEC counts were associated with the occurrence of MAKE-30 events. Follow-up measurements showed decreasing amounts of urinary TEC after AKI recovery over several days. ConclusionThe amount of urinary TEC directly reflects severity of tissue damage in human AKI. Our protocol furthermore provides a basis for a deeper phenotypic analysis of urinary TEC populations.